View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18913_high_12 (Length: 223)
Name: NF18913_high_12
Description: NF18913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18913_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 36955262 - 36955056
Alignment:
| Q |
1 |
caataagattgaaaaaggataatcatgagtttgtagacatattgagattgaaaacgtagttgacaagcttataatgaattatgtaaacataattaatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36955262 |
caataagattgaaaaaggataatcatgagtttgtagacatatagagattgaaaacgtagttgacaagctta--atgaattatgtaaacataattaatttt |
36955165 |
T |
|
| Q |
101 |
gggttttgaaaattactagatgttggatctatcgctatataattatatttgcctttctcaaaactatgtctagctgtcttgtaatgtgagagtccgtgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36955164 |
gggttttgaaaattactagatgttggatctatcgctatataattatctttgcctttctcaaaactatgtctagctgtcttgtaatgtgagagtccgtgca |
36955065 |
T |
|
| Q |
201 |
tcttgatcc |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
36955064 |
tcttgatcc |
36955056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University