View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18914_high_10 (Length: 253)
Name: NF18914_high_10
Description: NF18914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18914_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 23 - 244
Target Start/End: Complemental strand, 45512452 - 45512231
Alignment:
| Q |
23 |
tttccatgatgaaagcttgtttggtgaatcatgtgcaatggatgctttgaaattgagaagggcttgcctctctttttcaatacaggggatgtttgaattt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45512452 |
tttccatgatgaaagcttgtttggtgaatcatgtgcaatggatgctttgaaattgagaagggcttgcctctctttttcaatacaggggatgtttgaattt |
45512353 |
T |
 |
| Q |
123 |
acacacaagcatatttgtgcaatttcaatcaacaccaaaagtactacacatttgtaatatcttcccatgttttctatctctgtttctattgaaataattg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45512352 |
acacacaagcatatttgtgcaatttcaatcaacaccaaaagtactacacatttgtaatatcttcccatgttttctatctctgtttctattgaaataattg |
45512253 |
T |
 |
| Q |
223 |
aatgatggttttcatctcactc |
244 |
Q |
| |
|
||||||||||||||| |||||| |
|
|
| T |
45512252 |
aatgatggttttcatttcactc |
45512231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University