View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18914_low_10 (Length: 260)
Name: NF18914_low_10
Description: NF18914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18914_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 152 - 241
Target Start/End: Complemental strand, 25379385 - 25379296
Alignment:
| Q |
152 |
cttagatgaattatccacttcgtccttgtcatcattttcttcaagttgatctatattgttacaaatataaggagggtcgagttcatcatc |
241 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25379385 |
cttagatgaattatccacttcgtcctcgtcatcattttcttcaatttgatctatattgttacaaatataaggagggtcgagttcatcatc |
25379296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 15 - 70
Target Start/End: Complemental strand, 25379521 - 25379466
Alignment:
| Q |
15 |
gagatgaacgagagaactttttgggtggttctttagtagttttttctgaatcgcca |
70 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25379521 |
gagaagaacgagagaactttttgggtggttctttagtagttttttctgaatcgcca |
25379466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University