View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18914_low_12 (Length: 246)
Name: NF18914_low_12
Description: NF18914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18914_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 21 - 230
Target Start/End: Complemental strand, 42415131 - 42414917
Alignment:
| Q |
21 |
ttactttgaatgcaatagttagaatccagtatnnnnnnncaatctga-----atacataacctatataacattggatgttacaccttaaaataattgtct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42415131 |
ttactttgaatgcaatagttagaatccagtataaaaaaacaatctgaggtaaatacataacctatataacattggatgttaaaccttaaaataattgtct |
42415032 |
T |
|
| Q |
116 |
caatagaactttgtgtctttttaataaattcgacaatcttctttcacttttctttttgtacaagagtactttgtattttgaaatgcgaccagtttttatt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42415031 |
caatagaactttgtgtctttttaataaattcgacaatcttcttcaacttttctttttgtacaagagtactttgtattttgaaatgcgaccagtttttatt |
42414932 |
T |
|
| Q |
216 |
tcccattctttttaa |
230 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
42414931 |
tcccattctttttaa |
42414917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University