View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18914_low_18 (Length: 209)
Name: NF18914_low_18
Description: NF18914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18914_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 7 - 193
Target Start/End: Complemental strand, 14212966 - 14212780
Alignment:
| Q |
7 |
aggagaagcaaaggagatataaggagtgtttggtgtattatcaggtcatgctttatggagagattccatggtggagcagttattgcagcaataattcagc |
106 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14212966 |
aggagaaggcaaggagatataaggagtgtttggtgtattatcaggtcatgctttatggagagattccatggtggagcagttattgcagcaataattcagc |
14212867 |
T |
|
| Q |
107 |
aaattatatgtaagattaatcaatgagagaaattaactttctgtgttttgaagttcaatagtttgaggaataaagtagggactaaac |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14212866 |
aaattatatgtaagattaatcaatgagagaaattaactttctgtgttttgaagttcaatagtttgaggaataaagtagggactaaac |
14212780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University