View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18914_low_19 (Length: 201)
Name: NF18914_low_19
Description: NF18914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18914_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 25379498 - 25379689
Alignment:
| Q |
1 |
ccaaaaagttctctcgttcttctcggcgaagaaaaagacaaggtaaactaatcaatctatttgtttaattatcattttaatgactatattttatgtgctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25379498 |
ccaaaaagttctctcgttcttctcggcgaagaaaaagacaaggtaaactaatcaatctatttgtttaattatcattttaatgactatattttatgtgctt |
25379597 |
T |
 |
| Q |
101 |
attgtgcaagttttttcattctcacagtggaccaggctctgctgaatgattatgaacttggttctcgatcaatttctcttagggatattctt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25379598 |
attgtgcaagttttttcattctcacagtggaccaggctctgctggatgattatgaacttggttctcgatcaatttctcttagggatattctt |
25379689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 80 - 144
Target Start/End: Complemental strand, 38333619 - 38333555
Alignment:
| Q |
80 |
atgactatattttatgtgcttattgtgcaagttttttcattctcacagtggaccaggctctgctg |
144 |
Q |
| |
|
|||| ||||| |||| ||||||||||| |||| |||||||| ||| ||||||| ||||||||||| |
|
|
| T |
38333619 |
atgattatatattatatgcttattgtgaaagtattttcattttcatagtggacaaggctctgctg |
38333555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University