View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18915_high_11 (Length: 276)
Name: NF18915_high_11
Description: NF18915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18915_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 10 - 263
Target Start/End: Original strand, 17990687 - 17990940
Alignment:
| Q |
10 |
atcatatcaagtttttcctcctgaaaagccgaaacaaagtgttcaaaaggttagtgagatggaaaaggtgagtacaattcttttgtttgttgtactagtt |
109 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
17990687 |
atcatatcaagtttttcctactgaaaaaccgaaacaaagtgttcaaaaggtaagtaagatggaaaaggtgagtacaattcttttgtttgttgtactagct |
17990786 |
T |
|
| Q |
110 |
gcagtgcatgcaagtgcagcacgtactgttccaaatggagaaggtggccatgaagaaaagatgggtgaggtgcatgcaaatcttccagcacatgcagtaa |
209 |
Q |
| |
|
| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17990787 |
gtagtgcatgcaagtgcagcacgtacgattccaaatggagaaggtggccatgaagaaaagatgggtgaggtgcatgcaaatcttccagcacatgcagtaa |
17990886 |
T |
|
| Q |
210 |
gttcaactggtaagggtgttgatgacaagaagaatttcttggttggtggtgttg |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17990887 |
gttcaactggtaagggtgttgatgacaagaagaatttcttggttggtggtgttg |
17990940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University