View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18915_high_14 (Length: 251)
Name: NF18915_high_14
Description: NF18915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18915_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 18 - 234
Target Start/End: Original strand, 10519496 - 10519714
Alignment:
| Q |
18 |
ctttttgtggtgtataagtgtattgttcatactgtttctaaaatatgaggagtatgtgtaattgattgtctgtgt-gatactgttaccaagaagaagnnn |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10519496 |
ctttttgtggtgtataagtgtattgttcatactgtttctaaaatatgaggagtctgtgtaattgattgtctgtgttgatactgttaccaagaagaagaaa |
10519595 |
T |
|
| Q |
117 |
nnnnn-gagagaagggtacatctgtgtatatgatgagctgcgctctttcctctttgtcatcccaaatccctaattcagctttcttggggtgcactctatc |
215 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10519596 |
aaaaaagagagaagggtacatctgtgtatataatgagctgcgctctttcctctttgtcatcccaaatccctaattcagctttcttggggtgcactctatc |
10519695 |
T |
|
| Q |
216 |
tccttcttaaccaataatt |
234 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
10519696 |
tccttcttaaccaataatt |
10519714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University