View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18915_high_18 (Length: 240)
Name: NF18915_high_18
Description: NF18915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18915_high_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 50 - 232
Target Start/End: Complemental strand, 2919106 - 2918924
Alignment:
| Q |
50 |
caatgtgttacttcttctgaattattttgctagataatttgattgtttatacaagatttaaacttcaatagatttcttttaggctttgctgcataaggtt |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2919106 |
caatgtgttacttcttctgaattattttgctagataatttgattgtttatacaagatttaaacttcaatagatttcttttaggctttgctgcataaggtt |
2919007 |
T |
|
| Q |
150 |
aagcatattcttattaatttagaattctttgtatgcgtttttgttatccattcatagctgccactataactaacacctatgct |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2919006 |
aagcatattcttattaatttagaattctttgtatgcgtttttgttatccattcatagctgccactataactaacaccaatgct |
2918924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University