View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18915_low_13 (Length: 253)
Name: NF18915_low_13
Description: NF18915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18915_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 11 - 235
Target Start/End: Complemental strand, 49911803 - 49911579
Alignment:
| Q |
11 |
aatctagcgtggctttgaaattcaattaatgatttttacattaaaataaacaaggtatcaatatcaaacaacatgaatatccatgagggattacatttac |
110 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
49911803 |
aatctagcgtggcttcgaaattcaattaacgatttttacattaaaataaacaaggtatcaatatcaaacaacatgaatatccacgagggattacatttac |
49911704 |
T |
|
| Q |
111 |
tagtcttcttggtcaagctgaggattttgcgtatctaatttttgggtgtgtaaagttgacttggtattgtatgaagctttggagattatgggagaaaaga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49911703 |
tagtcttcttggtcaagctgaggattttgcgtatctaatttttgggtgcgtaaagttgacttggtattgtatgacgctttggagattatgggagaaaaga |
49911604 |
T |
|
| Q |
211 |
tatacgctttcggaaggtgcaactt |
235 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
49911603 |
tatacgctttcggaaggtgcaactt |
49911579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University