View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18915_low_20 (Length: 210)
Name: NF18915_low_20
Description: NF18915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18915_low_20 |
 | |
|
| [»] scaffold0171 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 15 - 192
Target Start/End: Original strand, 40644265 - 40644442
Alignment:
| Q |
15 |
aatatgcacaagaaaaaatgtaagaaagatcttttattgtttaaaatggacttcaagaaggcatatggtagcgtgaattgagactttttgagattaacct |
114 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40644265 |
aatatgcacaacaaaaaatgtaagaaagatcttttattgtttaaaatggactttgagaaggcatatgatagcgtgaattgagactttttgagattaacct |
40644364 |
T |
|
| Q |
115 |
ttactaaatttgggtctccttcttccattattaatttgaatggaacggtgaaaaacttgaaagcttcaaacctaaagg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
40644365 |
ttactaaatttgggtctccttcttccattattaatttgaatggaatggtgaaaaacttgaaagtttcaaacctaaagg |
40644442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0171 (Bit Score: 54; Significance: 3e-22; HSPs: 1)
Name: scaffold0171
Description:
Target: scaffold0171; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 18 - 151
Target Start/End: Complemental strand, 673 - 540
Alignment:
| Q |
18 |
atgcacaagaaaaaatgtaagaaagatcttttattgtttaaaatggacttcaagaaggcatatggtagcgtgaattgagactttttgagattaaccttta |
117 |
Q |
| |
|
||||||||||||||| ||| ||||||| |||||||||||||| ||||||| |||| || |||| ||| ||| |||| |||| |||||||||||| ||| |
|
|
| T |
673 |
atgcacaagaaaaaaggtatgaaagattttttattgtttaaagtggactttgagaaagcttatgatagggtggattggaacttattgagattaaccctta |
574 |
T |
|
| Q |
118 |
ctaaatttgggtctccttcttccattattaattt |
151 |
Q |
| |
|
|| ||||||||| |||| ||||||||| ||||| |
|
|
| T |
573 |
ctgaatttgggtttcctcattccattatgaattt |
540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 153
Target Start/End: Complemental strand, 1261543 - 1261408
Alignment:
| Q |
18 |
atgcacaagaaaaaatgtaagaaagatcttttattgtttaaaatggacttcaagaaggcatatggtagcgtgaattgagactttttgagattaaccttta |
117 |
Q |
| |
|
||||||||||||||| ||||||||| |||| || | ||||| ||||||| ||||||| |||| ||| || |||| || ||| | || ||||| ||| |
|
|
| T |
1261543 |
atgcacaagaaaaaaggtaagaaaggtcttctactatttaaggtggactttgagaaggcgtatgatagggtagattgggattttcttaggttaacttttt |
1261444 |
T |
|
| Q |
118 |
ctaaatttgggtctccttcttccattattaatttga |
153 |
Q |
| |
|
|| ||||||||| ||||||| |||||||||||||| |
|
|
| T |
1261443 |
ctgaatttgggtttccttctctcattattaatttga |
1261408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University