View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18916_low_4 (Length: 253)
Name: NF18916_low_4
Description: NF18916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18916_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 23 - 238
Target Start/End: Complemental strand, 43588006 - 43587789
Alignment:
| Q |
23 |
gagattatgtcggatgtgaaacctgctctaacttttaaagccaagtcgaaactattgtctcttgagtttgatatattttctcccaccattattcgggaga |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43588006 |
gagattatgtcggatgtgaaacctgctctaacttttaaagccaagtcgaaactattgtctcttgagtttgatatattttctcccaccattattcgggaga |
43587907 |
T |
|
| Q |
123 |
aagatacaaggtagaatctatatttatgcc--nnnnnnnnnnnnggcattcttgttagcaagcattatatgagtttactttgattattgttccttattca |
220 |
Q |
| |
|
|| ||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43587906 |
aatatacaaggtagaatctatatttatgcctttttttttttgttggtattcttgttagcaagcattatatgagtttactttgaatattgttccttattca |
43587807 |
T |
|
| Q |
221 |
tgataatgatgataatga |
238 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
43587806 |
tgataatgatgatgatga |
43587789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University