View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18917_low_14 (Length: 350)
Name: NF18917_low_14
Description: NF18917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18917_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 37 - 229
Target Start/End: Complemental strand, 35508179 - 35507987
Alignment:
| Q |
37 |
atggggggttcggtgcgagacgtgaagtcaaagtcggagttggatgaggttgttcgcggcggttctccggcggtgcttcacttctgggcgtcatggtgtg |
136 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35508179 |
atgggtggttcggtgcgagacgtgaagtcaaagtcggagttggatgaggtggttcgcggcggttctccggcggtgcttcacttctgggcgtcatggtgtg |
35508080 |
T |
 |
| Q |
137 |
aagcttccaaacacatggaccaactcttctctcatttggccattgatttccctcatacccatttcttaagggttcggttttctttcccaatta |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35508079 |
aagcttccaaacacatggaccaactcttctctcatttggccattgatttccctcatacccatttcttaagggttcggttttctttcccaatta |
35507987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 35507920 - 35507869
Alignment:
| Q |
296 |
ggttgaagctgaagaacaaccagagatatctgaggcttattctgtctctgct |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35507920 |
ggttgaagctgaagaacaaccagagatatctgaggcttattctgtctctgct |
35507869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University