View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18917_low_19 (Length: 247)

Name: NF18917_low_19
Description: NF18917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18917_low_19
NF18917_low_19
[»] chr3 (2 HSPs)
chr3 (1-233)||(29302416-29302648)
chr3 (114-231)||(29320148-29320265)


Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 29302416 - 29302648
Alignment:
1 taaacatgtagaaataatcatatggattatgttacagtatgcaatgattgcatatgaaatgaaaccacaatacgtgtatatatgagaacttgatagtgaa 100  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29302416 taaatatgtagaaataatcatatggattatgttacagtatgcaatgattgcatatgaaatgaaaccacaatacgtgtatatatgagaacttgatagtgaa 29302515  T
101 aatttcagattatgtaccttaagaagtacaagtaatgattctataattggttccccaaaagttgatattttgtctaagccacattgctttaccaaggaat 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
29302516 aatttcagattatgtaccttaagaagtacaagtaatgattctataattggttccccaaaagttgatattttgtctaagccacattgttttaccaaggaat 29302615  T
201 gaatggcagtaacagcatataactgcagaaaat 233  Q
    |||||||||||||||||||||||||||||||||    
29302616 gaatggcagtaacagcatataactgcagaaaat 29302648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 114 - 231
Target Start/End: Original strand, 29320148 - 29320265
Alignment:
114 gtaccttaagaagtacaagtaatgattctataattggttccccaaaagttgatattttgtctaagccacattgctttaccaaggaatgaatggcagtaac 213  Q
    |||||||||||||||| |||| |||| ||| |||  ||||||||||||  |||||||||||||||||||| |  ||||||||||| ||||||||  ||||    
29320148 gtaccttaagaagtacgagtactgatgctacaatatgttccccaaaaggcgatattttgtctaagccacaattttttaccaaggagtgaatggcgataac 29320247  T
214 agcatataactgcagaaa 231  Q
    ||||| | |||| |||||    
29320248 agcatttgactgaagaaa 29320265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University