View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18917_low_22 (Length: 234)
Name: NF18917_low_22
Description: NF18917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18917_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 18 - 147
Target Start/End: Original strand, 38254228 - 38254357
Alignment:
| Q |
18 |
ttatgcacattgggttgcctgaaaatgaaccgaaatgatatttttgtgtaacatgtccttactcaaccaaccatcgttataacttataattgcttttgcg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
38254228 |
ttatgcacattgggttgcctgaaaatgaaccaaaatgatatttttgtgtaacgtgtccttactcaaccaaccatcgttataacttataattgctttcgtg |
38254327 |
T |
 |
| Q |
118 |
gctactcatcatcatcaacaataagtgctt |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38254328 |
gctactcatcatcatcaacaataagtgctt |
38254357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 182 - 215
Target Start/End: Original strand, 38254420 - 38254453
Alignment:
| Q |
182 |
tagtggttaactatgttgatgttattgttagtat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38254420 |
tagtggttaactatgttgatgttattgttagtat |
38254453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University