View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18919_low_2 (Length: 250)
Name: NF18919_low_2
Description: NF18919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18919_low_2 |
 |  |
|
| [»] scaffold0172 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0172 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: scaffold0172
Description:
Target: scaffold0172; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 16 - 227
Target Start/End: Complemental strand, 8512 - 8301
Alignment:
| Q |
16 |
aacaatcgaattcgccttcattaggggataaaccaaatattgttaatgtgaagaatgaaacgaaacctatcgaacactctagtaaaggttattgtgaaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8512 |
aacaatcgaattcgccttcattaggggataaaccaaatattgttaatgtgaagaatgaaacgaaacctatcgaacactctagtaaaggttattgtgaaga |
8413 |
T |
 |
| Q |
116 |
ttcagaggatgacgatgatgataaaccattgagttctaagtggaagatcaaatctaatcatgataagaaagttgtagcccctgttgttatcaagaaatct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
8412 |
ttcagaggatgacgatgatgataaaccattgagttctaagtggaagatcaaatctaatcatgataacaaagttgtagctcctgttgttatcaagaaatct |
8313 |
T |
 |
| Q |
216 |
tctcaagactcg |
227 |
Q |
| |
|
|||||||||||| |
|
|
| T |
8312 |
tctcaagactcg |
8301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University