View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18919_low_3 (Length: 244)
Name: NF18919_low_3
Description: NF18919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18919_low_3 |
 | |
|
| [»] scaffold0041 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0041 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 16 - 76
Target Start/End: Complemental strand, 1529 - 1469
Alignment:
| Q |
16 |
ataaacacatcaatcaaatgtccnnnnnnnaaaataaatttcatttcttcggttcttttcc |
76 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1529 |
ataaacacatcaatcaaatgtcctttttttaaaataaatttcatttcttcggttcttttcc |
1469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University