View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18920_low_7 (Length: 245)
Name: NF18920_low_7
Description: NF18920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18920_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 26045358 - 26045118
Alignment:
| Q |
1 |
aaatctgtgatggtatgtatattggttcattttatttcatattctttgtttcgagaaattaaataatgcataggttgagttagctcatcaattattattg |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26045358 |
aaatctgttatggtatgtatattggttcattttatttcatattctttgtttcgagaaattaaataatgcataggttgagttagctcatcaattattattg |
26045259 |
T |
|
| Q |
101 |
gtttatgttttaacttgttttgattatacttgtttatg-nnnnnnnnngttcaggggattctctattaactgtcaagattggtttttcatttatttttct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26045258 |
ctttatgttttaacttgttttgattatacttgtttatgttttttttttgttcaggggattctctattaactgtcaagattggtttttcatttatttttct |
26045159 |
T |
|
| Q |
200 |
gttacttaattgggagtgttaattcaaattcaagatctgtg |
240 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26045158 |
gttgcttaattgggagtgttaattcaaattcaagatctgtg |
26045118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University