View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18921_high_7 (Length: 215)
Name: NF18921_high_7
Description: NF18921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18921_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 58 - 188
Target Start/End: Complemental strand, 44605406 - 44605277
Alignment:
| Q |
58 |
tgagtattcggtccgagggatcaactaatctcaaagactaattccaagcctctactagcaggggtcaaattgaagacataacaaacatattatttatgaa |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44605406 |
tgagtattcggtccgagggatcaactaatctcaaagactaattccaagcctctactagcaggggtcaaattgaagacataacaaaca---tatttatgaa |
44605310 |
T |
 |
| Q |
158 |
ttgatcca--acatgaattgttgatatctaaag |
188 |
Q |
| |
|
|||||||| |||| |||||||||||||||||| |
|
|
| T |
44605309 |
ttgatccaacacataaattgttgatatctaaag |
44605277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University