View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18921_low_12 (Length: 289)
Name: NF18921_low_12
Description: NF18921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18921_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 26 - 161
Target Start/End: Original strand, 46099578 - 46099713
Alignment:
| Q |
26 |
catctatttggcctattagtgcattaattcgtcacgatgttatagttgcagtgtgcaactccaaaaatggaatatatcttgatattttctccctctttca |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46099578 |
catctatttggcctattagtgcattaattcgtcacaatgttatagttgcagtgtgcaactccaaaaatggaatatatcttgatattttctccctctttca |
46099677 |
T |
|
| Q |
126 |
aacaaaagtcaagtcagatggtactggatggaactg |
161 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46099678 |
aacaaaagtcaagtcagatggtactggatagaactg |
46099713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 162 - 280
Target Start/End: Original strand, 46099745 - 46099863
Alignment:
| Q |
162 |
cccattttatactcctagtttctctttctcttatcaaagatgtgaaaagatttatgttatgtgtttttggtgaatattatctcacaccaaaattatgatt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
46099745 |
cccattttatactcctagtttctctttctcatatcaaagatgtgaaaagatttatgttatgtgtttttggtgaatcttatctcacatcaaaattatgatt |
46099844 |
T |
|
| Q |
262 |
tcgaatatggtgttcattt |
280 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
46099845 |
tcgaatatggtgttcattt |
46099863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University