View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18922_high_2 (Length: 310)
Name: NF18922_high_2
Description: NF18922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18922_high_2 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 13 - 310
Target Start/End: Original strand, 41637664 - 41637961
Alignment:
| Q |
13 |
catcatcatctgattacgcaggaacacctcctcaacctcgtagtggtcattccgctgttaatattggaaaatccaaggttgtcatcttcggtggtcttgt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41637664 |
catcatcatctgattacgcaggaacacctcctcaacctcgtagtggtcattccgctgttaatattggaaaatccaaggttgtcgtcttcggtggtcttgt |
41637763 |
T |
 |
| Q |
113 |
cgacaaaaaatttctcactgatattcttgtctatgatattggttagtgacccttttctctcttcttttgtgggttgttgtcaaaatttggaatttgattc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41637764 |
cgacaaaaaatttctcactgatattcttgtctatgatattggttagtgacccttttctctcttcttttgtgggttgttgtcaaaatttggaatttgattc |
41637863 |
T |
 |
| Q |
213 |
gttttgtaatgttgaaattttcagaggctaagctatggtatcaaccggagtgtactggaagtgattcagatggacatgtgggtcccactccacgagca |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41637864 |
gttttgtaatgttgaaattttcagaggctaagctatggtatcaaccggagtgtactggaagtgattcagatggacatgtgggtcccactccacgagca |
41637961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University