View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18922_low_3 (Length: 247)
Name: NF18922_low_3
Description: NF18922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18922_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 41637953 - 41638191
Alignment:
| Q |
1 |
ccacgagcatttcatgttgctgttgctattgattgtcatatgtttgtttttggtggccgttctggtggtcagaggtctagttactgtttcagnnnnnnnc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41637953 |
ccacgagcatttcatgttgctgttgctattgattgtcatatgtttgtttttggtggccgttctggtggtcagaggtctagttactgtttcagtttttttt |
41638052 |
T |
 |
| Q |
101 |
attt---------ctcactatcttatcattacatgttttgtagatcacttagaatacattgagaaagagttaatcttgattatacttagaccctatttgg |
191 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41638053 |
attttttttatttctcactatcttatcattacatgttttgtagatcacttagaatacattgagaaagagttaatcttgattatacttagaccctatttgg |
41638152 |
T |
 |
| Q |
192 |
gtaaacaactaaactataaatgtacatataagtgcttat |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41638153 |
gtaaacaactaaactataaatgtacatataagtgcttat |
41638191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University