View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18923_low_1 (Length: 282)
Name: NF18923_low_1
Description: NF18923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18923_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 79; Significance: 6e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 165 - 266
Target Start/End: Complemental strand, 19414991 - 19414892
Alignment:
| Q |
165 |
taatcttcccattatcagttttcccgaatggatgaaatttatgttacaacttggtgttctgtaccttaatctctttataggcatcttgatgtgcctaaat |
264 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19414991 |
taatcttctcattatcagttttcccgaatggatcaaatttatgttaca--tttgtgttctgtaccttaatctctttataggcatcttgatgtgcctaaat |
19414894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 138 - 168
Target Start/End: Complemental strand, 19415069 - 19415039
Alignment:
| Q |
138 |
gcatgctgatattaatgacatgccaattaat |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
19415069 |
gcatgctgatattaatgacatgccaattaat |
19415039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University