View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18924_low_10 (Length: 348)
Name: NF18924_low_10
Description: NF18924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18924_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 71 - 333
Target Start/End: Complemental strand, 870501 - 870239
Alignment:
| Q |
71 |
accctttttgctttaacttagctggattcattcataattcaataaattttacattttcatgcaannnnnnngtaacccaagttcaagatatgtgttcatt |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
870501 |
accctttttgctttaacttagctggattcattcataattcaataaattttacattttcatgcaatttttttgtaacccaaattcaagatatgtgttcatt |
870402 |
T |
|
| Q |
171 |
tctgtttgtaattgtgttatagtgcttagatcttaattgggtctatctaattatttttattgcttnnnnnnnnctcaccttttccaatctaggttttatt |
270 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
870401 |
tctttttgtaattgtgttatagtgcttagatcttaattgggtctatctaattatttttattgcttaaaaaaaactcaccttttccaatctaggttttatt |
870302 |
T |
|
| Q |
271 |
ctttgctatgtttacttaaactctaaatgcaaatttaacatttttaagagtgattgttttgat |
333 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
870301 |
ctttgctatgtttaattaaactctaaatgcaaatttaacatttttaagagtgattgttttgat |
870239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University