View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18924_low_15 (Length: 318)
Name: NF18924_low_15
Description: NF18924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18924_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 1 - 308
Target Start/End: Original strand, 1248066 - 1248373
Alignment:
| Q |
1 |
atattcaatatcggatttatgtgcatgaatatgattgcttatataagaatacatacctcactgagcaaggtgcctagagacttatcgtcggaggccttaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1248066 |
atattcaatatcggatttatgtgcatgaatatgattgcttatataagaatacatacctcactgagcaaggtgcctagagacttatcgtcagaggccttaa |
1248165 |
T |
|
| Q |
101 |
cggtctcctcagctttggtctccttggcttgctgttcaaccttaacctcctcggtgacaggctcggggacagggactggagcgtcactttcgtcggtcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1248166 |
cggtctcctcagctttggtctccttggcttgctgttcaaccttaacctcctcggtgacaggctcagggacagggactggagcgtcactttcgtcggtcct |
1248265 |
T |
|
| Q |
201 |
agggttgccagcacagttgcccattttcaatgattattattaataaatgtacaatgtgggagaacaagccaagtaatttggtcttgttcttgatttgttc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1248266 |
agggttgccagcacagttgcccattttcaatgattattattaataaatgtacaatgtgggagaacaagccaagtaagttggtcttgttcttgatttgttc |
1248365 |
T |
|
| Q |
301 |
tccctttg |
308 |
Q |
| |
|
|||||||| |
|
|
| T |
1248366 |
tccctttg |
1248373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University