View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18924_low_19 (Length: 245)
Name: NF18924_low_19
Description: NF18924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18924_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 125 - 228
Target Start/End: Complemental strand, 29661391 - 29661288
Alignment:
| Q |
125 |
aattttgggaaattttcataggttacatggaattttaactagttcgaagttatgatgaactagatgaaattcaaagccaaatttcaaactggctgtaacc |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
29661391 |
aattttgggaaattttcataggttacatggaattttaactagttcgaagttatgatgaagtagatgaaattcaaagccaaatttcaaacttgctctaacc |
29661292 |
T |
 |
| Q |
225 |
attg |
228 |
Q |
| |
|
|||| |
|
|
| T |
29661291 |
attg |
29661288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 29661487 - 29661391
Alignment:
| Q |
1 |
ttgttaggtcatgtaatgagctaggcagtta--atgttgttggtctaagtggagatggtaattataagcttatgatttgttctgtttgttgatgata |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29661487 |
ttgttaggtcatgtaatgagctaggcagttataatgttgttggtctaagtggagatgataattataagcttatgatttcttctgtttgttgatgata |
29661391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University