View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18924_low_8 (Length: 390)
Name: NF18924_low_8
Description: NF18924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18924_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 1e-72; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 140 - 286
Target Start/End: Original strand, 12285060 - 12285206
Alignment:
| Q |
140 |
ggttatgtttgactggttttctccctattgattgcttctttctctctgttggatcatctatttgattgattttccacctcttggttcttatatttgattg |
239 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12285060 |
ggttacgtttgactggttttctccctattgattgcttctttctctctgttggatcatctatttgattgattttccatctcttggttcttatatttgattg |
12285159 |
T |
 |
| Q |
240 |
ttcttctgtttgattgatcttatccctatcggttcttatgtttggtt |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12285160 |
ttcttctgtttgattgatcttatccctatcggttcttatgtttggtt |
12285206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 12284710 - 12284853
Alignment:
| Q |
1 |
acgacacggtatagggtttgtttgttattattctcgttgcaatatggatttgttgcatttctattatagaattgattatgagctggttagtcaattctta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12284710 |
acgacacggtatagggtttgtttgttattattctcgttgcaatatgggtttgttgcatttctattatagaattgattatgagctggttagtcaattctta |
12284809 |
T |
 |
| Q |
101 |
ttttactgtgtttctctgctgatttgtgttcgaattgtgggtta |
144 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
12284810 |
ttttactgtgtttctatgctgatttgtgttcaaattgtgggtta |
12284853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 306 - 385
Target Start/End: Original strand, 12285270 - 12285349
Alignment:
| Q |
306 |
atttgttcttatgttttggttgcttctccctaccggtttttctatttcctttggattggaattgattggtctgtgctcct |
385 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |||| |
|
|
| T |
12285270 |
atttgttattatgttttggttgcttctccctaccggtttttctatttgctttggattggaattgattggtttgtgatcct |
12285349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University