View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18925_low_8 (Length: 357)
Name: NF18925_low_8
Description: NF18925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18925_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 32 - 346
Target Start/End: Complemental strand, 29858209 - 29857890
Alignment:
| Q |
32 |
cgtacccgagttattgtttcttcatagcatacaacagt---agaaacttttgaaactgtgttggaattccatgtgattcttaaaagggtgtgtgtgagag |
128 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29858209 |
cgtacctgagttatggtttcttcatagcatacaacagttcgagaaacttttgaaactgtgttggaattccgtgtgattcttaaaagggtgtgtgtgagag |
29858110 |
T |
 |
| Q |
129 |
gattcaagttggtttgtgtatgagaatgaaag--ggnnnnnnnnnctagaagcacatttggatggagcttatttgccttagatgaagagagatttagatc |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29858109 |
gattcaagttggtttgtgtatgagaatgaaagaagaagaaaaaaactagaagcacttttggatggagcttatttcccttagatgaagagagatttagatc |
29858010 |
T |
 |
| Q |
227 |
atagtcttctcaaggattggagcttggttattctctaaaagtcttgaaatttcatctataagaaagtggaaataacatggcatatgtgatttgggcatgg |
326 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29858009 |
atagtcttctcagagattgaagcttggttattctctaaaagtcttgaaatttcatccataagaaagtggaaatagcatggcatatgtgatttgggcatgg |
29857910 |
T |
 |
| Q |
327 |
cctgcaatctactgtttcat |
346 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
29857909 |
cctgcaatctactgtttcat |
29857890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 17 - 91
Target Start/End: Original strand, 9683532 - 9683609
Alignment:
| Q |
17 |
gtttcaccaactatgcgtacccgagttattgtttcttcatagcatacaacagt---agaaacttttgaaactgtgttg |
91 |
Q |
| |
|
||||||||||||||| ||| | ||||||| | |||| |||||||||||||||| |||| |||||||| |||||||| |
|
|
| T |
9683532 |
gtttcaccaactatgtgtagctgagttatggcttctccatagcatacaacagtttgagaagcttttgaatctgtgttg |
9683609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University