View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18926_high_19 (Length: 448)
Name: NF18926_high_19
Description: NF18926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18926_high_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 260; Significance: 1e-145; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 153 - 430
Target Start/End: Complemental strand, 21484600 - 21484326
Alignment:
| Q |
153 |
acaccattgaaaaccattgcatgtacttcaactacaacaactactacctcttcttcttcctcagcttcttcttcatctgcagcttcttgggctgttttga |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21484600 |
acaccattgaaaaccattgcatgtacttcaactacaacaactactacctcttcttcttcctcagcttcttcttcatctgcagcttcttgggctgttttga |
21484501 |
T |
|
| Q |
253 |
aatcagatgttgaagtagatcatcaaggttatcatcaaaaacatggtcatccattagattatcatcatggtcatcctccaacaactttgtcatcaactgc |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21484500 |
aatcagatgttgaagtagatcatcaaggttatca---aaaacatggtcatccattagattatcatcatggtcatcctccaacaactttgtcatcaactgc |
21484404 |
T |
|
| Q |
353 |
ttctatggagatttctcagcaacagcaacaagatcttggtgtttctaacaatgatgttgttgttggtggtggtgattg |
430 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21484403 |
ttctatggagatttctcaacaacagcaacaagatcttggtgtttctaacaatgatgttgttgttggtggtggtgattg |
21484326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 16 - 122
Target Start/End: Complemental strand, 21484737 - 21484631
Alignment:
| Q |
16 |
ataatactacaaatgatcaagatggtgatcttttaggtatgaatatgaatgatgatgcatctatgttctatgctgattttccacctttacctgattttcc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21484737 |
ataatactacaaatgatcaagatggtgatcttttaggtatgaatatgaatgatgatgcatctatgttctatgctgattttcctcctttacctgattttcc |
21484638 |
T |
|
| Q |
116 |
atgcatg |
122 |
Q |
| |
|
||||||| |
|
|
| T |
21484637 |
atgcatg |
21484631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University