View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18926_high_28 (Length: 407)
Name: NF18926_high_28
Description: NF18926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18926_high_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 379; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 379; E-Value: 0
Query Start/End: Original strand, 1 - 391
Target Start/End: Original strand, 3810588 - 3810978
Alignment:
| Q |
1 |
taaaatttgacttataattggtgcaggtatgcttcggagatggctgtgatatttatccaatctgcaatatacataggaataatagcaatgacgcatttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3810588 |
taaaatttgacttataattggtgcaggtatgcttcggagatggctgtgatatttatccaatctgcaatatacataggaataatagcaatgacgcgtttgg |
3810687 |
T |
 |
| Q |
101 |
caaggccgagcctctcaaaaatatgttttaggcgttccgataagagcatcaccctggcacacaacagcctaaaattagtagcattgtggtgcatacttgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3810688 |
caaggccgagcctctcaaaaatatgttttaggcgttccgataagagcatcaccctggcacacagcagcctaaaattagtagcattgtggtgcatacttgc |
3810787 |
T |
 |
| Q |
201 |
tgcttacgtaacacctgtctttatcatacctcacacaattcaccctctacttggttggatcctgtattttcttggttcttttgcattttgctcaattgca |
300 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3810788 |
tgcttacgtaacaccagtctttatcatacctcacacaattcaccctctacttggttggatcctgtattttcttggttcttttgcattttgctcaattgca |
3810887 |
T |
 |
| Q |
301 |
attaatatctttcttctaccaatgttaccagttttggtaccttggcttgggattcttggagtcctaatggttatggcatttccttggtatc |
391 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3810888 |
attaatatctttcttctaccaatgttaccagttttggtaccttggcttgggattcttggagtcctaatggttatggcatttccttggtatc |
3810978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 40 - 182
Target Start/End: Complemental strand, 41672925 - 41672783
Alignment:
| Q |
40 |
atggctgtgatatttatccaatctgcaatatacataggaataatagcaatgacgcatttggcaaggccgagcctctcaaaaatatgttttaggcgttccg |
139 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||| | |||||||||||| |||| | |||||||||||| |||||||||||| |||| | | || || | |
|
|
| T |
41672925 |
atggctgtgatacttattcaatcagcaatatatcttggaataatagcactgactcgtttggcaaggccaagcctctcaaaattatgctaccgccgctctg |
41672826 |
T |
 |
| Q |
140 |
ataagagcatcaccctggcacacaacagcctaaaattagtagc |
182 |
Q |
| |
|
||||||||||||| ||| ||| |||| ||| ||| ||||||| |
|
|
| T |
41672825 |
ataagagcatcacattggtacaaaacatcctcaaactagtagc |
41672783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University