View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18926_high_39 (Length: 294)
Name: NF18926_high_39
Description: NF18926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18926_high_39 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 29 - 294
Target Start/End: Original strand, 1249197 - 1249463
Alignment:
| Q |
29 |
caaagttatatgccaaaaccgcaacacaacagggaattaagtcaccatatatgatattcgaaaaacaagagtagcatttcgaactttcaaccaccaaaaa |
128 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1249197 |
caaagttatatgccaaaaccgcaatacaacagggaattaagtcatcatatatgataatcgaaaaacaagagtagcatttcgaactttcaaccaccaaaaa |
1249296 |
T |
 |
| Q |
129 |
gagaggagttgtattttgtttactagttgctgcagcaattcttccttatttttgaagattttattatttatttctttctaaataactcaaacatatgaaa |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1249297 |
gagaggagttgtattttgtttactagttgctgcagcaattcttccttatttttgaagattttattatttatttctttctaaataactcaaacatatgaaa |
1249396 |
T |
 |
| Q |
229 |
ttaagcataaactttt-agaagatttactagtatgagcaaattgaagaaaatggtccgatagtcgat |
294 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1249397 |
ttaagcataaacttttaagaagatttactagtatgagcaaattgaagaaaatggtccgatagtcgat |
1249463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University