View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18926_high_52 (Length: 246)
Name: NF18926_high_52
Description: NF18926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18926_high_52 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 18 - 118
Target Start/End: Original strand, 31940502 - 31940602
Alignment:
| Q |
18 |
agtatgtccaaagagagaaagatctactttatgtgaagaattttcacccactagtgctcgctgaagctaaactgggtagcaagatcgttgatgagtagat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31940502 |
agtatgtccaaagagagaaagatctactttatgtgaagaattttcacccactagtgctcgctgaagcaaaactgggtagcaagatcgttgatgagtagat |
31940601 |
T |
|
| Q |
118 |
t |
118 |
Q |
| |
|
| |
|
|
| T |
31940602 |
t |
31940602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 156 - 246
Target Start/End: Original strand, 31940606 - 31940696
Alignment:
| Q |
156 |
taaaatcctacacttaattcacatagctcaaacacctaaaacacaatcaattcacatatacttaagatttttgaataaaactcacagaaat |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |||| ||||||||||||| |
|
|
| T |
31940606 |
taaaatcctacacttaattcacatagctcaaacacctaaaacacaatcaattcagatatacttaaaattttttaatacaactcacagaaat |
31940696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University