View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18926_low_40 (Length: 330)
Name: NF18926_low_40
Description: NF18926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18926_low_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 175 - 312
Target Start/End: Complemental strand, 2782520 - 2782383
Alignment:
| Q |
175 |
tgttgttggtaacagcaacacagtggttacaaagggagatagtgggtacaaacttgggtccagtgccatgccaaggtgttaaagattgacaaatatggca |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2782520 |
tgttgttggtaacagcaacacagtggttacaaagggagatagtgggtacaaacttgggtccagtgccatgccaaggtgttaaagattgacaaatatggca |
2782421 |
T |
|
| Q |
275 |
gagaagaaacctgtgatgctttgtgactatgaagtttg |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2782420 |
gagaagaaacctgtgatgctttgtgactatgaagtttg |
2782383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 2782691 - 2782576
Alignment:
| Q |
1 |
agaaaaattacaggatatatatttatactagttggtagcattagtttgcactatttgaagaacaagaagaaactggtggtggagttgtagatttccatgg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2782691 |
agaaaaattacaggaaatatatttatactagttggtagcattagtttgcactatttgaagaacaagaagaaactggtggtggagttgtagatttccatgg |
2782592 |
T |
|
| Q |
101 |
aaccacttgattttct |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
2782591 |
aaccacttgattttct |
2782576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University