View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18926_low_43 (Length: 294)

Name: NF18926_low_43
Description: NF18926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18926_low_43
NF18926_low_43
[»] chr2 (1 HSPs)
chr2 (29-294)||(1249197-1249463)


Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 29 - 294
Target Start/End: Original strand, 1249197 - 1249463
Alignment:
29 caaagttatatgccaaaaccgcaacacaacagggaattaagtcaccatatatgatattcgaaaaacaagagtagcatttcgaactttcaaccaccaaaaa 128  Q
    |||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
1249197 caaagttatatgccaaaaccgcaatacaacagggaattaagtcatcatatatgataatcgaaaaacaagagtagcatttcgaactttcaaccaccaaaaa 1249296  T
129 gagaggagttgtattttgtttactagttgctgcagcaattcttccttatttttgaagattttattatttatttctttctaaataactcaaacatatgaaa 228  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1249297 gagaggagttgtattttgtttactagttgctgcagcaattcttccttatttttgaagattttattatttatttctttctaaataactcaaacatatgaaa 1249396  T
229 ttaagcataaactttt-agaagatttactagtatgagcaaattgaagaaaatggtccgatagtcgat 294  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
1249397 ttaagcataaacttttaagaagatttactagtatgagcaaattgaagaaaatggtccgatagtcgat 1249463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University