View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18926_low_44 (Length: 291)
Name: NF18926_low_44
Description: NF18926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18926_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 268; Significance: 1e-150; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 268; E-Value: 1e-150
Query Start/End: Original strand, 2 - 277
Target Start/End: Original strand, 32321946 - 32322221
Alignment:
| Q |
2 |
agatgaaccaacctacacacaagaaatctttacactcaaaatggcacgcacaattgcacaatactgcagcttataataatatatctaagcctcccgttaa |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32321946 |
agatgaaccaacctacacacaagaaatctttacactcaaaatggcacgcacaattgcacaatactgcagcttataataatatatctaagcctcccgttaa |
32322045 |
T |
 |
| Q |
102 |
ccctttttgtttcagttacatcagtaaaaatatgagatgaagaccttaactaaacaaaaatattgcaaatcgtaataacacatcaagcagaccatctgtt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32322046 |
ccctttttgtttcagttacatcagtaaaaatatgagatgaagacctttactaaacaaaaatattgcaaatcgtaataacacatcaagcagaccatttgtt |
32322145 |
T |
 |
| Q |
202 |
atatacagtcctcaactgacatttggagcatggtcatgcggattacacaattttgcctcattcatggacataactg |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32322146 |
atatacagtcctcaactgacatttggagcatggtcatgcggattacacaattttgcctcattcatggacataactg |
32322221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University