View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18926_low_56 (Length: 250)
Name: NF18926_low_56
Description: NF18926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18926_low_56 |
 | |
|
| [»] scaffold0454 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 7)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 251846 - 252067
Alignment:
| Q |
1 |
caacatctccaaaaactgaatttggctgctaacaatttcaatagagatttctcgactcaaaaggtggtaactcttgatatctctattaattcttactcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
251846 |
caacatctccaaaaactgaatttggctgctaacaatttcaatagagatttctcgactcaaaatgtggtaactcttgatatctctattaattcttactcac |
251945 |
T |
|
| Q |
101 |
tgggacgagagctgaaacttgagaactcaaatctacaaagcaagggcatgaatggggcaatgctttgttgccgctgtgtgatctgcaagagttgagcatg |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
251946 |
tgggacgagagctgaaacttgagacctcaaatctacaaagcaagggcatgaatggggcaatgctttgttgccgctgtgtgatctgcaagagttgagcatg |
252045 |
T |
|
| Q |
201 |
tctaactgtgaatcgatctatca |
223 |
Q |
| |
|
|||||||||| |||||||||||| |
|
|
| T |
252046 |
tctaactgtg-atcgatctatca |
252067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 149 - 211
Target Start/End: Complemental strand, 5553842 - 5553780
Alignment:
| Q |
149 |
tgaatggggcaatgctttgttgccgctgtgtgatctgcaagagttgagcatgtctaactgtga |
211 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| || |||||||||||||||| ||||||||| |
|
|
| T |
5553842 |
tgaatggagcaatgctttgttgccgctgtgtgaactacaagagttgagcatgtataactgtga |
5553780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 209
Target Start/End: Original strand, 5885920 - 5885981
Alignment:
| Q |
148 |
atgaatggggcaatgctttgttgccgctgtgtgatctgcaagagttgagcatgtctaactgt |
209 |
Q |
| |
|
|||||||| | ||||||||||| |||||| |||| |||||||||||||||||| ||||||| |
|
|
| T |
5885920 |
atgaatggagtaatgctttgttaccgctgcgtgacttgcaagagttgagcatgtataactgt |
5885981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 147 - 211
Target Start/End: Complemental strand, 3749587 - 3749523
Alignment:
| Q |
147 |
catgaatggggcaatgctttgttgccgctgtgtgatctgcaagagttgagcatgtctaactgtga |
211 |
Q |
| |
|
||||||| | ||||||||||||||||| || |||| ||||||| |||||||||||| ||||||| |
|
|
| T |
3749587 |
catgaattgagcaatgctttgttgccgttgcgtgacttgcaagaattgagcatgtcttactgtga |
3749523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 147 - 203
Target Start/End: Original strand, 5847704 - 5847760
Alignment:
| Q |
147 |
catgaatggggcaatgctttgttgccgctgtgtgatctgcaagagttgagcatgtct |
203 |
Q |
| |
|
||||||||| |||||||||||||||| || |||| |||||| |||||||||||||| |
|
|
| T |
5847704 |
catgaatggagcaatgctttgttgcctttgcgtgacctgcaaaagttgagcatgtct |
5847760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 142 - 208
Target Start/End: Complemental strand, 5559649 - 5559583
Alignment:
| Q |
142 |
aagggcatgaatggggcaatgctttgttgccgctgtgtgatctgcaagagttgagcatgtctaactg |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| || ||| ||| |||| ||| |||||||||||| |
|
|
| T |
5559649 |
aagggcatgaatggagcaatgctttgttgccgttgcgtggtctagaagaactgaccatgtctaactg |
5559583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 5582605 - 5582646
Alignment:
| Q |
1 |
caacatctccaaaaactgaatttggctgctaacaatttcaat |
42 |
Q |
| |
|
|||||||| |||||| |||| ||||||||||||||||||||| |
|
|
| T |
5582605 |
caacatcttcaaaaattgaacttggctgctaacaatttcaat |
5582646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0454 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0454
Description:
Target: scaffold0454; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 142 - 200
Target Start/End: Complemental strand, 1076 - 1018
Alignment:
| Q |
142 |
aagggcatgaatggggcaatgctttgttgccgctgtgtgatctgcaagagttgagcatg |
200 |
Q |
| |
|
|||| ||||||||| ||||||| |||||||||||| |||| ||||||| |||||||||| |
|
|
| T |
1076 |
aaggacatgaatggagcaatgccttgttgccgctgcgtgagctgcaagtgttgagcatg |
1018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 142 - 200
Target Start/End: Complemental strand, 1485894 - 1485836
Alignment:
| Q |
142 |
aagggcatgaatggggcaatgctttgttgccgctgtgtgatctgcaagagttgagcatg |
200 |
Q |
| |
|
|||| ||||||||| ||||||| |||||||||||| |||| ||||||| |||||||||| |
|
|
| T |
1485894 |
aaggacatgaatggagcaatgccttgttgccgctgcgtgagctgcaagtgttgagcatg |
1485836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University