View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18926_low_59 (Length: 246)

Name: NF18926_low_59
Description: NF18926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18926_low_59
NF18926_low_59
[»] chr7 (2 HSPs)
chr7 (18-118)||(31940502-31940602)
chr7 (156-246)||(31940606-31940696)


Alignment Details
Target: chr7 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 18 - 118
Target Start/End: Original strand, 31940502 - 31940602
Alignment:
18 agtatgtccaaagagagaaagatctactttatgtgaagaattttcacccactagtgctcgctgaagctaaactgggtagcaagatcgttgatgagtagat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
31940502 agtatgtccaaagagagaaagatctactttatgtgaagaattttcacccactagtgctcgctgaagcaaaactgggtagcaagatcgttgatgagtagat 31940601  T
118 t 118  Q
    |    
31940602 t 31940602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 156 - 246
Target Start/End: Original strand, 31940606 - 31940696
Alignment:
156 taaaatcctacacttaattcacatagctcaaacacctaaaacacaatcaattcacatatacttaagatttttgaataaaactcacagaaat 246  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |||| |||||||||||||    
31940606 taaaatcctacacttaattcacatagctcaaacacctaaaacacaatcaattcagatatacttaaaattttttaatacaactcacagaaat 31940696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University