View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18927_high_15 (Length: 261)
Name: NF18927_high_15
Description: NF18927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18927_high_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 27 - 243
Target Start/End: Original strand, 2758784 - 2759001
Alignment:
| Q |
27 |
ttgaaatagattgaaaaatgggaggacaaagtaatgaagtagaatgtgtgagaaagattttaaagagggaaatgtgagaaagggtgaagactgaagagag |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2758784 |
ttgaaatagattgaaaaatgggaggacaaagtaatgaagtagaatgtgtgagaaagattttaaagagggaaatgtgagaaagggtgaagactgaagagag |
2758883 |
T |
|
| Q |
127 |
catggacaaacataaaaggccaatgaatcagaaaagtttgttatttgagactctttatgtgtt-nnnnnnnngggtccacttgaattctctttttgttga |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2758884 |
catggacaaacataaaaggccaatgaatcagaaaagtttgttatttgagactctttatgtgttaaaaaaaaagggtccacttgaattctctttttgttga |
2758983 |
T |
|
| Q |
226 |
gtttgtgcattttcatgc |
243 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
2758984 |
gtttgtgcattttcatgc |
2759001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University