View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18927_high_22 (Length: 226)
Name: NF18927_high_22
Description: NF18927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18927_high_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 8)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 32565526 - 32565380
Alignment:
| Q |
1 |
ccaatcttcaatataatttctatagggattcttgccctcaagctgaagatattgttcgttccgctgttaccgatatctactttgatcatagagaccttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32565526 |
ccaatcttcaatataatttctatagggattcttgccctcaagctgaagatattgttcgttccgctgttaccgatatctactttgatcatagagaccttgc |
32565427 |
T |
 |
| Q |
101 |
accttctcttcttcgtctcttctttcatgattgcttcatccaggtaa |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32565426 |
accttctcttcttcgtctcttctttcatgattgcttcatccaggtaa |
32565380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 32806711 - 32806565
Alignment:
| Q |
1 |
ccaatcttcaatataatttctatagggattcttgccctcaagctgaagatattgttcgttccgctgttaccgatatctactttgatcatagagaccttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32806711 |
ccaatcttcaatataatttctatagggattcttgccctcaagctgaagatattgttcgttccgctgttaccgatatctactttgatcatagagaccttgc |
32806612 |
T |
 |
| Q |
101 |
accttctcttcttcgtctcttctttcatgattgcttcatccaggtaa |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32806611 |
accttctcttcttcgtctcttctttcatgattgcttcatccaggtaa |
32806565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 32815148 - 32815002
Alignment:
| Q |
1 |
ccaatcttcaatataatttctatagggattcttgccctcaagctgaagatattgttcgttccgctgttaccgatatctactttgatcatagagaccttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32815148 |
ccaatcttcaatataatttctatagggattcttgccctcaagctgaagatattgttcgttccgctgttaccgatatctactttgatcatagagaccttgc |
32815049 |
T |
 |
| Q |
101 |
accttctcttcttcgtctcttctttcatgattgcttcatccaggtaa |
147 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32815048 |
accttctcttcttcgtcttttctttcatgattgcttcatccaggtaa |
32815002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 32309309 - 32309455
Alignment:
| Q |
1 |
ccaatcttcaatataatttctatagggattcttgccctcaagctgaagatattgttcgttccgctgttaccgatatctactttgatcatagagaccttgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32309309 |
ccaatcttcaatataatttctatagggattcttgccctcaagctgaagataatgttcgttccgctgttaccgatatctactttgatcatagagaccttgc |
32309408 |
T |
 |
| Q |
101 |
accttctcttcttcgtctcttctttcatgattgcttcatccaggtaa |
147 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32309409 |
accttctcttcttcgtcttttctttcatgattgcttcatccaggtaa |
32309455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 32799757 - 32799640
Alignment:
| Q |
1 |
ccaatcttcaatataatttctatagggattcttgccctcaagctgaagatattgttcgttccgctgttaccgatatctactttgatcatagagaccttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32799757 |
ccaatcttcaatataatttctatagggattcttgccctcaagctgaagatattgttcgttccgctgttaccgatatctactttgatcatagagaccttgc |
32799658 |
T |
 |
| Q |
101 |
accttctcttcttcgtct |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
32799657 |
accttctcttcttcgtct |
32799640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 28215758 - 28215614
Alignment:
| Q |
1 |
ccaatcttcaatataatttctatagggattcttgccctcaagctgaagatattgttcgttccgctgttaccgatatctactttgatcatagagaccttgc |
100 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||| ||||||| |||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
28215758 |
ccaatcttcgatataatttctataaggattcttgccctgaagctgagaatattgttcgttccgctgttaccgatatttactctgatcatagagaccttgc |
28215659 |
T |
 |
| Q |
101 |
accttctcttcttcgtctcttctttcatgattgcttcatccaggt |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28215658 |
accttctcttcttcgtctcttctttcatgattgcttcatccaggt |
28215614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 1 - 145
Target Start/End: Original strand, 28220466 - 28220607
Alignment:
| Q |
1 |
ccaatcttcaatataatttctatagggattcttgccctcaagctgaagatattgttcgttccgctgttaccgatatctactttgatcatagagaccttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||| |||||||||||||||||||||||||||| |||||| |||||||||||| ||| |
|
|
| T |
28220466 |
ccaatcttcaatataatttctataaggtttcttgccctcaagctgagaatattgttcgttccgctgttaccgatatttactttaatcatagagacc-tgc |
28220564 |
T |
 |
| Q |
101 |
accttctcttcttcgtctcttctttcatgattgcttcatccaggt |
145 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28220565 |
accttctcttcttcgtctct--tttcatgattgcttcatccaggt |
28220607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 104 - 147
Target Start/End: Original strand, 32305344 - 32305387
Alignment:
| Q |
104 |
ttctcttcttcgtctcttctttcatgattgcttcatccaggtaa |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32305344 |
ttctcttcttcgtctcttctttcatgattgcttcatccaggtaa |
32305387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 301455 - 301601
Alignment:
| Q |
1 |
ccaatcttcaatataatttctatagggattcttgccctcaagctgaagatattgttcgttccgctgttaccgatatctactttgatcatagagaccttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
301455 |
ccaatcttcaatataatttctatagggattctagccctcaagctgaagatattgttccttccgctgttaccgatatctaccttgatcatagagaccttgc |
301554 |
T |
 |
| Q |
101 |
accttctcttcttcgtctcttctttcatgattgcttcatccaggtaa |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
301555 |
accttctcttcttcgtctcttctttcatgattgcttcatccacgtaa |
301601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University