View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18927_high_23 (Length: 226)

Name: NF18927_high_23
Description: NF18927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18927_high_23
NF18927_high_23
[»] chr8 (3 HSPs)
chr8 (17-175)||(1433012-1433170)
chr8 (175-206)||(1433197-1433228)
chr8 (116-148)||(16715463-16715495)


Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 17 - 175
Target Start/End: Original strand, 1433012 - 1433170
Alignment:
17 atttttgctcctacattttttgtnnnnnnnntattcttattgtattttacttggaattttggtttcttggttatacagtgaaaattaatgagttggagat 116  Q
    |||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1433012 atttttgctcctacattttttgtaaaaaaactattcttattgtattttacttggaattttggtttcttggttatacagtgaaaattaatgagttggagat 1433111  T
117 tgatagggataagatatatgatagaacattattgcgttctttgtaaaacgtgagtttgc 175  Q
     ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
1433112 agatagagataagatatatgatagaacattattgcgttctttgtaaaacgtgagtttgc 1433170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 206
Target Start/End: Original strand, 1433197 - 1433228
Alignment:
175 cacttagtggcgggacttgattgttgttgtta 206  Q
    ||||||||||||||||||||||||||||||||    
1433197 cacttagtggcgggacttgattgttgttgtta 1433228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 116 - 148
Target Start/End: Original strand, 16715463 - 16715495
Alignment:
116 ttgatagggataagatatatgatagaacattat 148  Q
    |||||||||||| ||||||||||||||||||||    
16715463 ttgatagggatatgatatatgatagaacattat 16715495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University