View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18927_low_23 (Length: 227)
Name: NF18927_low_23
Description: NF18927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18927_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 146 - 214
Target Start/End: Original strand, 11142514 - 11142582
Alignment:
| Q |
146 |
actgtattgtcttatctcttgaaaaaatgcatcgtgatggtagacaactagttaaaggcagttcttctc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11142514 |
actgtattgtcttatctcttgaaaaaatgcatcgtgatggtagacaactagttaaaggcagttcttctc |
11142582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 11142386 - 11142453
Alignment:
| Q |
18 |
aaaacatatcatttcattccttttttagttccttaacttgtaccctaacaagttagcatgacccttgt |
85 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11142386 |
aaaacgtatcatttcactccttttttagttccttaacttgtaccctaacaagttagcatgacccttgt |
11142453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 159 - 214
Target Start/End: Complemental strand, 46710072 - 46710017
Alignment:
| Q |
159 |
atctcttgaaaaaatgcatcgtgatggtagacaactagttaaaggcagttcttctc |
214 |
Q |
| |
|
||||||||||||| | ||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46710072 |
atctcttgaaaaacttcattgtgatggtaggcaactagttaaaggcagttcttctc |
46710017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University