View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18927_low_25 (Length: 226)
Name: NF18927_low_25
Description: NF18927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18927_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 17 - 175
Target Start/End: Original strand, 1433012 - 1433170
Alignment:
| Q |
17 |
atttttgctcctacattttttgtnnnnnnnntattcttattgtattttacttggaattttggtttcttggttatacagtgaaaattaatgagttggagat |
116 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1433012 |
atttttgctcctacattttttgtaaaaaaactattcttattgtattttacttggaattttggtttcttggttatacagtgaaaattaatgagttggagat |
1433111 |
T |
 |
| Q |
117 |
tgatagggataagatatatgatagaacattattgcgttctttgtaaaacgtgagtttgc |
175 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1433112 |
agatagagataagatatatgatagaacattattgcgttctttgtaaaacgtgagtttgc |
1433170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 206
Target Start/End: Original strand, 1433197 - 1433228
Alignment:
| Q |
175 |
cacttagtggcgggacttgattgttgttgtta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1433197 |
cacttagtggcgggacttgattgttgttgtta |
1433228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 116 - 148
Target Start/End: Original strand, 16715463 - 16715495
Alignment:
| Q |
116 |
ttgatagggataagatatatgatagaacattat |
148 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
16715463 |
ttgatagggatatgatatatgatagaacattat |
16715495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University