View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18927_low_26 (Length: 221)

Name: NF18927_low_26
Description: NF18927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18927_low_26
NF18927_low_26
[»] chr5 (2 HSPs)
chr5 (108-202)||(8417886-8417980)
chr5 (22-55)||(8418033-8418066)


Alignment Details
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 108 - 202
Target Start/End: Complemental strand, 8417980 - 8417886
Alignment:
108 gtattcgaacgaaatttcatttttgtagtctcttgatgtttttaatatctcttaatctttttaatcccctctaatatctttgtcttcttcggtgc 202  Q
    |||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
8417980 gtattcgaacgaaatttcatttttgtagtctctttatctttttaatatctcttaatctttttaatcccctctaatatctttgtcttcttcagtgc 8417886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 22 - 55
Target Start/End: Complemental strand, 8418066 - 8418033
Alignment:
22 aaaaaagtatgatttcggaaagaagaagcagaac 55  Q
    ||||||||||||||||||||||||||||||||||    
8418066 aaaaaagtatgatttcggaaagaagaagcagaac 8418033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University