View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18927_low_26 (Length: 221)
Name: NF18927_low_26
Description: NF18927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18927_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 108 - 202
Target Start/End: Complemental strand, 8417980 - 8417886
Alignment:
| Q |
108 |
gtattcgaacgaaatttcatttttgtagtctcttgatgtttttaatatctcttaatctttttaatcccctctaatatctttgtcttcttcggtgc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8417980 |
gtattcgaacgaaatttcatttttgtagtctctttatctttttaatatctcttaatctttttaatcccctctaatatctttgtcttcttcagtgc |
8417886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 22 - 55
Target Start/End: Complemental strand, 8418066 - 8418033
Alignment:
| Q |
22 |
aaaaaagtatgatttcggaaagaagaagcagaac |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8418066 |
aaaaaagtatgatttcggaaagaagaagcagaac |
8418033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University