View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18928_high_22 (Length: 315)
Name: NF18928_high_22
Description: NF18928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18928_high_22 |
 |  |
|
| [»] scaffold0012 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 100 - 197
Target Start/End: Original strand, 20212523 - 20212620
Alignment:
| Q |
100 |
aaggagagacttggttggagggatgtcaggactccaaactctcctagcctaatgaattttctgccccatggaggatttctgcatataagcttctttaa |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
20212523 |
aaggagagacttggttggagggatgtcaggactccaaactctcctggcctaatgaattttctgccccatggaggatttctggatataagcttctttaa |
20212620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 100 - 197
Target Start/End: Original strand, 22106546 - 22106643
Alignment:
| Q |
100 |
aaggagagacttggttggagggatgtcaggactccaaactctcctagcctaatgaattttctgccccatggaggatttctgcatataagcttctttaa |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22106546 |
aaggagagacttggttggagggatgtcaggactccaaactctcctggcctaatgaattttctgccccatggaggatttctggatataagcttctttaa |
22106643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 242 - 296
Target Start/End: Complemental strand, 22806447 - 22806393
Alignment:
| Q |
242 |
accttgagtctttaatcttgagatttgctcggagagcaaaagcttaagtgtgggg |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22806447 |
accttgagtctttaatcttgagatttgctcgaagagcaaaagcttaagtgtgggg |
22806393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0012 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 162
Target Start/End: Complemental strand, 146812 - 146678
Alignment:
| Q |
30 |
aagccattgagcatcctctttctataagcttgtcatctgtaggaactctatcatgcatgattctctaagtaaggagagacttggttg--gagggatgtca |
127 |
Q |
| |
|
|||||||||| ||||||||||| ||||| |||||||| || || ||||||||||||||||||||| | |||| ||||||||| | | ||||||||||| |
|
|
| T |
146812 |
aagccattgaacatcctctttccataagtttgtcatcggtggggactctatcatgcatgattctccaggtaaagagagacttagagggagagggatgtca |
146713 |
T |
 |
| Q |
128 |
ggactccaaactctcctagcctaatgaattttctg |
162 |
Q |
| |
|
|||||||||| || ||||| ||| | ||||||| |
|
|
| T |
146712 |
acactccaaactttcttagcccaattacttttctg |
146678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University