View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18928_high_25 (Length: 301)
Name: NF18928_high_25
Description: NF18928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18928_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 1 - 283
Target Start/End: Original strand, 50492079 - 50492361
Alignment:
| Q |
1 |
gaaatagaggaactgactcgagaaagttatcattgtagagatcttctccatcttcctcttcctctggatcgggttcgtcgcgaatgatatcgggatcaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
50492079 |
gaaatagaggaactgactcgagaaagttatcattgtagagatcttctccatcttcctcttcctctggatcgggttcatcgcgaatgatatcgggatcaac |
50492178 |
T |
 |
| Q |
101 |
ggaagcttcgtcgtcttcagatgcgcggctggtgtgagtgtgaggaagttgatcagtgttgaaaccggcggatggtgaggttggtgaatcgggagttgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50492179 |
ggaagcttcgtcgtcttcagatgcgcggctggtgtgagtgtgaggaagttgatcagtgttgaaaccggcggatggtgaagttggtgaatcgggagttgat |
50492278 |
T |
 |
| Q |
201 |
gcaggattttctggatccatgattcttcgcttcttctcttctagctctgaagtgtttcaatttcagttttgctctgaagaatt |
283 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
50492279 |
gcaggattttctggatccatgattcttcacttcttctcttctagctctgaagtgtttcaatttcagtttcgctctgaataatt |
50492361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University