View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18928_high_34 (Length: 254)

Name: NF18928_high_34
Description: NF18928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18928_high_34
NF18928_high_34
[»] chr5 (2 HSPs)
chr5 (138-251)||(16578655-16578770)
chr5 (18-133)||(16578508-16578622)


Alignment Details
Target: chr5 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 138 - 251
Target Start/End: Original strand, 16578655 - 16578770
Alignment:
138 taaaataaattaatacaa--tataagataacattgaatgattcgatgaggagtatatattcgaccaaactacgtgagtatcgttttgttgatctaattat 235  Q
    ||||||||||||||| ||  |||| |||||| ||||| ||||||||||||||||||||||| ||||||||||  ||||||| ||  |||||| |||||||    
16578655 taaaataaattaatataaaatatacgataacgttgaacgattcgatgaggagtatatattcaaccaaactacacgagtatcattgcgttgatttaattat 16578754  T
236 atatgagaaatttata 251  Q
    | || |||| ||||||    
16578755 acatcagaagtttata 16578770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 18 - 133
Target Start/End: Original strand, 16578508 - 16578622
Alignment:
18 catgtcgctaaaatttgtgacgagaaaaaccaagagagttttcannnnnnnnnnngttggtaaattaattatatgataaattttgacatacttcgaagtt 117  Q
    |||||| ||||| |||||||||||||||||| ||| ||||||||           ||||||||||||||||||||||||||||| | |||||| ||||||    
16578508 catgtcactaaattttgtgacgagaaaaaccgagaaagttttcatttttttttt-gttggtaaattaattatatgataaatttttagatactttgaagtt 16578606  T
118 tgattgaatattgata 133  Q
    || |||||||||||||    
16578607 tggttgaatattgata 16578622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University