View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18928_high_36 (Length: 251)
Name: NF18928_high_36
Description: NF18928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18928_high_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 16789939 - 16789695
Alignment:
| Q |
1 |
ttattttgtaggtggtacctagttgaatataattatgagacaagctttcattacttcagataattttttaatcaactatttcatttatttaattggtttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16789939 |
ttattttgtaggtggtacctagttgaatataattatgagacaagctt-cattacttcagataattttttaatcaactatttcatttatctaattggtttc |
16789841 |
T |
 |
| Q |
101 |
atgatttcactttaaatattgcattctgtacatttttgctaatatttatttgaacatggctatgttccttcgaaggataattta---attggaatccata |
197 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
16789840 |
atgatttctctttaaatattgcattctgtacatttttgctaatacttatttgaacatggctatattccttcgaaggataatttaattattggaatccata |
16789741 |
T |
 |
| Q |
198 |
cactaagtatttgagagtttaggtaattattttttcgattcatctc |
243 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16789740 |
cactccgtatttgagagtttaggtaattattttttcgattcatctc |
16789695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University