View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18928_high_47 (Length: 222)
Name: NF18928_high_47
Description: NF18928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18928_high_47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 14 - 205
Target Start/End: Original strand, 28106982 - 28107173
Alignment:
| Q |
14 |
gtgaaggaggtcactagtactacagcatgatagctggtttctttcatgagaaaatgatatttgtacatgtggtcgttcaactgcttttagcaacatgaca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28106982 |
gtgaaggaggtcactagtactacagcatgatagctggtttctttcatgagaaaatgatatttgtacatgtggtcgttcaactgcttttagcaacatgaca |
28107081 |
T |
|
| Q |
114 |
aaggacaaagtttttcacaccatgtctcacgttattggggaagtgagaataggtgtgaccgatatatttggtatggctttgaattgaggaaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28107082 |
aaggacaaagtttttcacaccatgtctcacgttattggggaagtgagaataggtgtgaccgatatatttggtatggttttgaattgaggaaa |
28107173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University