View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18928_low_12 (Length: 414)
Name: NF18928_low_12
Description: NF18928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18928_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 156 - 398
Target Start/End: Original strand, 11202184 - 11202426
Alignment:
| Q |
156 |
ccctaatcatgcccgcaatgaacaaccgcaagaagaattcacgcgacccatttttcgacgacggtcccaccaaacgccgtagagtagccgccgacgagga |
255 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11202184 |
ccctaatcatgcccgctaagaacaaccgcaagaagaattcacgcgacccatttttcgacgacggtcccaccaaacgccgcagagtagccgccgacgagga |
11202283 |
T |
 |
| Q |
256 |
tcaagatgctgagattgaaagtgatagtgattttgacgaagatggttttgttccatcgaaaggtgaaggggaacaggagtctgaagaggaaactacagct |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11202284 |
tcaagatgctgagattgaaagtgatagtgattttgacgaagatggttttgttccatcgaaaggtgaaggggaacaggagtctgaagaggaaactacagct |
11202383 |
T |
 |
| Q |
356 |
gaagctaggaagagactagctgaggagtatttgaggaagttta |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11202384 |
gaagctaggaagagactagctgaggagtatttgaggaagttta |
11202426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 4 - 106
Target Start/End: Original strand, 11202035 - 11202134
Alignment:
| Q |
4 |
gaaaataaaaacatttgtaacttctacacaccgttcaaccgagagacataaacccactcatttctgaaacttaaaccctagcagcaacctttgtctttgt |
103 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11202035 |
gaaaataaaaacatttgtaaattctacac--cgttcaaccgagagacataaacccactcatttctgaaacttaaaccctagcagcaacctttgt-tttgt |
11202131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University