View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18928_low_28 (Length: 288)
Name: NF18928_low_28
Description: NF18928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18928_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 16 - 270
Target Start/End: Complemental strand, 47124517 - 47124261
Alignment:
| Q |
16 |
atcacacaatctaattggtccaagtcatcatataatctcatccacatcaacaacactcttccaaaatcattaacttacaaactagtactagtg--atatt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47124517 |
atcacacaatctaattggtccaagtcatcatataatctcatccacatcaacaacactcttccaaaatcattaacttacaaactagtactagtgtgatatt |
47124418 |
T |
 |
| Q |
114 |
gatctttcacaagcccaacacactttcctcgcaatactacaagcaacatttgtatccaactcacaatggccatggcaactcaaaccaccctcttcacccc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47124417 |
gatctttcacaagcccaacacactttcctcgcaatactacaagcaacatttgtatccaactcacaatggccatggcaactcaaaccaccctcttcacccc |
47124318 |
T |
 |
| Q |
214 |
acctttctctagtgccaaacccaatgaacatgtctcagtaccatggaaacaatcacc |
270 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47124317 |
acctttctttagtgccaaacccaatgaacatgtctcagtaccatggaaacaatcacc |
47124261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University